![vchat molecular weight sigma vchat molecular weight sigma](https://www.nzytech.com/wp-content/uploads/2015/12/LMW_II-Protein-Marker-300x300.jpg)
As each cell has one nearest neighbour, one Voronoi domain, but an average of five Delaunay segments, the Delaunay segments offer the most stable statistics. This analysis was performed by means of a custom-made program, as described ( Galli-Resta et al., 1997). Analysis of cell spacing was based on the Delaunay segment (DS) distribution, determined as follows: first the domain including all the points in the plane closer to the cell than to any other element of the array is computed (Voronoi domain) then, the Delaunay segments are determined, which link each cell to those with adjacent domains ( Grumnbaum and Shephard, 1989). The higher the average density ratio and its standard deviation, the more density varies within an array. The average density ratio is close to 1 and has a limited standard deviation when the density of cells in the array varies little across adjacent fields. For every pair of fields in the cluster (9×8/2=36 pairs), we computed the density ratio, dividing the higher by the lower density value in the pair. To evaluate the variation of the density of array cells across adjacent fields, we subdivided each 400×400μm 2 sampled region with a grid in order to obtain a cluster of nine non-overlapping 125×125 μm 2 adjacent fields, and computed array cell density within each of these fields. The total number of cells in each array was determined as the average cell density times the retinal area. Intraocular concentrations were similarly estimated at later ages. The final intraocular concentration was estimated on the basis of a value of 10-15 μl of vitreal volume, estimated by weighing neonatal eyes ( n=10 P0-P2) with and without the vitreous body. Fixed volume of 200 nl were injected in the vitreous body. Paclitaxel (Molecular Probes 10 μg/ml), demecolchid (Molecular Probes 10 –3 M), nocodazole (Sigma 5 μM) were dissolved in PBS containing DMSO (<10 –3% intraocular concentration). FITC-conjugated oligos with the above sequences were used to control for oligo penetration. Oligos were either phosphorothioated (PP) or phosphorothioated-modified at only the 5′ and 3′ ends (pp). The tau antisense oligo was RT11 (GGCTTTGAAGCAGCATGGCTGAACC), described previously ( Caceres and Kosik, 1990). The MAP2 antisense oligonucleotides were RM21 (CTCGTCAGCCATCCTTCAGATCTCT) and RM38 (GTACTGTCTCCTAATCAAGTTGTAA), described elsewhere ( Caceres et al., 1992). TreatmentsĪntisense and sense oligonucleotides were obtained from Pharmacia and dissolved in phosphate-buffered saline (PBS). Jessel), BrdU, tau (Roche), calbindin, MAP2ab, MAP1, MAP5, β-tubulin (Sigma) and βFGF (Upstate). Antibodies sources: ChAT (Chemicon), islet 1 (clone 4D5 gift of T. Horizontal cells were labelled with calbindin antibodies. Cholinergic cells were detected by choline acetyltrasferase (ChAT) or islet 1 expression. Immunocytochemistry for cytoskeletal components was performed after simultaneous extraction and fixation, using a buffer described elsewhere ( Schliwa et al., 1981). Eye collection, fixation, dissection, retina flat mounting, sectioning, single and double immunostaining were performed as described ( Galli-Resta et al., 1997). BrdU pellets were applied subcutaneously on postnatal day 0 (P0 n=2), or P2 ( n=2), or P4 ( n=2), as described ( Galli-Resta and Ensini, 1996). Intraocular injections and optic nerve section in neonatal rats were performed under anaesthesia as described ( Galli-Resta et al., 1997). The geometry of cell spacing within retinal arrays has provided important cues on the mechanisms controlling mosaic assembly, showing that many arrays derive their orderly organization from an exclusion rule: each cell is surrounded by a limited domain where other cells of that same type are never positioned ( Cellerino et al., 2000 Cook and Chalupa, 2000 Galli-Resta, 1998 Galli-Resta, 2000 Galli-Resta et al., 1999).Įxperiments were performed on Long Evan hooded rats in compliance to the national and the ARVO regulation on animal experimentation. Regular distributions of photoreceptors, amacrine and horizontal cells are observed before all the layers of the retina have been generated, and often before all the cells forming the mature arrays are born or have migrated to their layers ( Bumsted et al., 1997 Bruhn and Cepko, 1996 Cook and Chalupa, 2000 Galli-Resta et al., 1997 Larison and Bremiller, 1990 Raymond et al., 1995 Scheibe et al., 1995 Wikler et al., 1997). Studies ranging from fish to primates have shown that the emergence of non-random arrays of like cells in the retina is an early step in development.